pCapV
(Plasmid
#183028)
-
Purposethe patatin-like phosphodiesterase CapV from the animal commensal strain Escherichia coli ECOR31 cloned in the L-arabinose inducible vector pBAD28
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD28
-
Backbone manufacturerBeckwith Lab
- Backbone size w/o insert (bp) 5801
- Total vector size (bp) 6885
-
Vector typeBacterial Expression
-
Selectable markerschloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namepatatin-like phospholipase CapV
-
Alt namelocus tag: BHF03_RS01975
-
SpeciesEscherichia coli ECOR31
-
Insert Size (bp)1102
-
GenBank IDGCA_001865905.1
- Promoter pBAD promoter
-
Tag
/ Fusion Protein
- No
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer VC0178-81-SacI-fw GGCGAGCTCGCTATATTCTCTGGTTATGGGGTTTTCAATGTCTG
- 3′ sequencing primer VC0178-XbaI-rv GCTCTAGATCAGAGTTTCTCCTGCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.11.22.387274v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCapV was a gift from Ute Romling (Addgene plasmid # 183028 ; http://n2t.net/addgene:183028 ; RRID:Addgene_183028) -
For your References section:
Patatin-like phospholipase CapV in Escherichia coli - morphological and physiological effects of one amino acid substitution. Li F, Cao L, Bahre H, Kim SK, Schroeder K, Jonas K, Koonce K, Mekonnen SA, Mohanty S, Bai F, Brauner A, Lee VT, Rohde M, Romling U. NPJ Biofilms Microbiomes. 2022 May 11;8(1):39. doi: 10.1038/s41522-022-00294-z. 10.1038/s41522-022-00294-z PubMed 35546554