pJEC619
(Plasmid
#182955)
-
PurposeSYNZIP18-Cascade.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182955 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep15A
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 6428
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSynZip18-Cascade
-
SpeciesE. coli
-
Insert Size (bp)4492
-
MutationSynZip18 fusion to CasA
- Promoter J23150
-
Tag
/ Fusion Protein
- SynZip18 (N terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer tttacggctagctcagtcctag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC619 was a gift from James Chappell (Addgene plasmid # 182955 ; http://n2t.net/addgene:182955 ; RRID:Addgene_182955) -
For your References section:
Uncovering the Distinct Properties of a Bacterial Type I-E CRISPR Activation System. Villegas Kcam MC, Tsong AJ, Chappell J. ACS Synth Biol. 2022 Jan 25. doi: 10.1021/acssynbio.1c00496. 10.1021/acssynbio.1c00496 PubMed 35077145