alpha7nACHR_Nacho_GCAMP7s
(Plasmid #182940)

• Purpose: alpha7 nACHR expression in mammalian cell lines with calcium reporter
• Depositing Lab: Robert Brenner
• Publication: Belanger-Coast et al Eur J Pharmacol. 2022 Jun 15;925:175000. doi: 10.1016/j.ejphar.2022.175000. Epub 2022 May 4.

Backbone

• Vector backbone: synthesized
• Backbone manufacturer: Vectorbuilder
• Total vector size (bp): 8636
• Modifications to backbone: EF1 alpha promoter driving NACH7_IRES_Nacho, CMV promoter driving GCAMP7s-CAAX
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NACH7
• Alt name: alpha7 nicotinic acetylcholine receptor
• Species: H. sapiens (human)
• Insert Size (bp): 1509
• Entrez Gene: CHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
• Promoter: EF1alpha

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: synthesized based on Genbank Sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Human NACH7 expression plasmid coexpressing mouse NACHO chaperone protein for mammalian expression of alpha7 nicotinic acetylcholine receptors in mammalian cells. The plasmid contains the membrane targeted (CAAX sequence) GCAMP7s calcium reporter to detect NACH7 mediated calcium influx.