Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

alpha7nACHR_Nacho_GCAMP7s
(Plasmid #182940)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182940 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    synthesized
  • Backbone manufacturer
    Vectorbuilder
  • Total vector size (bp) 8636
  • Modifications to backbone
    EF1 alpha promoter driving NACH7_IRES_Nacho, CMV promoter driving GCAMP7s-CAAX
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NACH7
  • Alt name
    alpha7 nicotinic acetylcholine receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1509
  • Entrez Gene
    CHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
  • Promoter EF1alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    synthesized based on Genbank Sequence
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Human NACH7 expression plasmid coexpressing mouse NACHO chaperone protein for mammalian expression of alpha7 nicotinic acetylcholine receptors in mammalian cells. The plasmid contains the membrane targeted (CAAX sequence) GCAMP7s calcium reporter to detect NACH7 mediated calcium influx.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    alpha7nACHR_Nacho_GCAMP7s was a gift from Robert Brenner (Addgene plasmid # 182940 ; http://n2t.net/addgene:182940 ; RRID:Addgene_182940)
  • For your References section:

    Dequalinium chloride is an antagonists of alpha7 nicotinic acetylcholine receptors. Belanger-Coast MG, Zhang M, Bugay V, Gutierrez RA, Gregory SR, Yu W, Brenner R. Eur J Pharmacol. 2022 Jun 15;925:175000. doi: 10.1016/j.ejphar.2022.175000. Epub 2022 May 4. 10.1016/j.ejphar.2022.175000 PubMed 35525312