alpha7nACHR_Nacho_mCherry
(Plasmid #182939)

• Purpose: alpha7 nACHR expression in mammalian cell lines
• Depositing Lab: Robert Brenner
• Publication: Belanger-Coast et al Eur J Pharmacol. 2022 Jun 15;925:175000. doi: 10.1016/j.ejphar.2022.175000. Epub 2022 May 4.

Backbone

• Vector backbone: synthesized
• Vector type: Mammalian Expression ; Synthesized

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NACH7
• Alt name: alpha7 nicotinic acetylcholine receptor
• Species: H. sapiens (human)
• Insert Size (bp): 1508
• GenBank ID: U40583.2
• Entrez Gene: CHRNA7 (a.k.a. CHRNA7-2, NACHRA7)
• Promoter: EF1alpha

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthesized based on Genbank sequence
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

alpha7 nicotinic acetylcholine receptor cloned upstream of IRES-Nacho sequence to allow alpha7 expression in mammalian cells with chaperone protein NACHO (TMEM35a). The plasmid contains CMV-mCherry to report transfected cells.