pIN4_tsp-6_mScarlet
(Plasmid
#182935)
-
PurposeExpresses tsp-6::mScarlet under its native promoter (amphid and phasmid ciliated neurons in C. elegans)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIN1_GGGSx3_mScarlet
-
Backbone manufacturerMaureen Barr lab (Nikonorova et al 2022)
- Backbone size w/o insert (bp) 4358
- Total vector size (bp) 8254
-
Modifications to backboneinsertion of Ptsp-6::tsp-6::flexible linker::mScarlet
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNone
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePtsp-6-3::tsp-6::flexible linker::mScarlet (C. elegans, genomic)
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)3897
-
GenBank IDNM_001307901.3
- Promoter tsp-6
-
Tag
/ Fusion Protein
- flexible linker (GGGGS)x3 and mScarlet tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCGAATGATACTAACATAACATAGAAC
- 3′ sequencing primer TAGGGATGTTGAAGAGTAATTGGACTTAGAAGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIN4_tsp-6_mScarlet was a gift from Maureen Barr (Addgene plasmid # 182935 ; http://n2t.net/addgene:182935 ; RRID:Addgene_182935) -
For your References section:
Isolation, profiling, and tracking of extracellular vesicle cargo in Caenorhabditis elegans. Nikonorova IA, Wang J, Cope AL, Tilton PE, Power KM, Walsh JD, Akella JS, Krauchunas AR, Shah P, Barr MM. Curr Biol. 2022 May 9;32(9):1924-1936.e6. doi: 10.1016/j.cub.2022.03.005. Epub 2022 Mar 24. 10.1016/j.cub.2022.03.005 PubMed 35334227