hSOD1-FLAG
(Plasmid #182922)

• Purpose: Mammalian expression plasmid for human WT SOD1
• Depositing Lab: Philip Eaton
• Publication: Switzer et al Proc Natl Acad Sci U S A. 2023 Jan 17;120(3):e2205044120. doi: 10.1073/pnas.2205044120. Epub 2023 Jan 11.

Backbone

• Vector backbone: pcDNA3.1+/C-(K)-DYK
• Backbone size w/o insert (bp): 5444
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: [Cu-Zn] Superoxide dismutase 1
• Alt name: SOD1
• Species: H. sapiens (human)
• Insert Size (bp): 462
• GenBank ID: OHu24018D
• Entrez Gene: SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TGGGAGGTCTATATAAGCAGAG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • 1_SOD1_OHu24018D_pcDNA3.1+_C-(K)-DYK.gb
• A portion of this plasmid was derived from a plasmid made by: Synthesized by GenScript Biotech.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry