Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP-Ki-67(RASA)-mCherry_IRESpuro2
(Plasmid #182921)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182921 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRESpuro2
  • Total vector size (bp) 16356
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MKI67
  • Species
    H. sapiens (human)
  • Mutation
    RASA mutation
  • Entrez Gene
    MKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
  • Promoter CMV
  • Tags / Fusion Proteins
    • EGFP (N terminal on backbone)
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer ATTCCAGCACACTGGATCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-Ki-67(RASA)-mCherry_IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 182921 ; http://n2t.net/addgene:182921 ; RRID:Addgene_182921)
  • For your References section:

    Chromosome clustering by Ki-67 excludes cytoplasm during nuclear assembly. Cuylen-Haering S, Petrovic M, Hernandez-Armendariz A, Schneider MWG, Samwer M, Blaukopf C, Holt LJ, Gerlich DW. Nature. 2020 Nov;587(7833):285-290. doi: 10.1038/s41586-020-2672-3. Epub 2020 Sep 2. 10.1038/s41586-020-2672-3 PubMed 32879492