EGFP-Ki-67(RASA)-mCherry_IRESpuro2
(Plasmid
#182921)
-
PurposeExpresses EGFP-Ki-67(RASA)-mCherry. Ki67 contains RASA mutation.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRESpuro2
- Total vector size (bp) 16356
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMKI67
-
SpeciesH. sapiens (human)
-
MutationRASA mutation
-
Entrez GeneMKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (N terminal on backbone)
- mCherry (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
- 3′ sequencing primer ATTCCAGCACACTGGATCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-Ki-67(RASA)-mCherry_IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 182921 ; http://n2t.net/addgene:182921 ; RRID:Addgene_182921) -
For your References section:
Chromosome clustering by Ki-67 excludes cytoplasm during nuclear assembly. Cuylen-Haering S, Petrovic M, Hernandez-Armendariz A, Schneider MWG, Samwer M, Blaukopf C, Holt LJ, Gerlich DW. Nature. 2020 Nov;587(7833):285-290. doi: 10.1038/s41586-020-2672-3. Epub 2020 Sep 2. 10.1038/s41586-020-2672-3 PubMed 32879492