Skip to main content
Addgene

Lenti_EGFP-P2A-siRNAresHAUS6_IRES_Blast
(Plasmid #182887)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182887 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Transfer vector for Lentivirus production
  • Total vector size (bp) 13235
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HAUS 6
  • Alt name
    FAM29A
  • Species
    H. sapiens (human)
  • Mutation
    silet mutations in aa 197 - 203 to confer resistance to Haus6 siRNA
  • Entrez Gene
    HAUS6 (a.k.a. Dgt6, FAM29A)
  • Promoter EF1alpha core
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer CAAGTGTATGGCCAGATCTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lenti_EGFP-P2A-siRNAresHAUS6_IRES_Blast was a gift from Daniel Gerlich (Addgene plasmid # 182887 ; http://n2t.net/addgene:182887 ; RRID:Addgene_182887)

  • For your References section:

    Augmin accumulation on long-lived microtubules drives amplification and kinetochore-directed growth. David AF, Roudot P, Legant WR, Betzig E, Danuser G, Gerlich DW. J Cell Biol. 2019 Jul 1;218(7):2150-2168. doi: 10.1083/jcb.201805044. Epub 2019 May 21. 10.1083/jcb.201805044 PubMed 31113824
Related items: