Lenti_EGFP-P2A-HAUS6_IRES_Blast
(Plasmid #182886)

• Purpose: Transfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (WT full length)
• Depositing Lab: Daniel Gerlich
• Publication: David et al J Cell Biol. 2019 Jul 1;218(7):2150-2168. doi: 10.1083/jcb.201805044. Epub 2019 May 21.

Backbone

• Vector backbone: Transfer vector for Lentivirus production
• Total vector size (bp): 13235
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: HAUS 6
• Species: H. sapiens (human)
• Insert Size (bp): 2868
• Entrez Gene: HAUS6 (a.k.a. Dgt6, FAM29A)
• Promoter: EF1alpha core
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: CAAGTGTATGGCCAGATCTC

Resource Information

• Supplemental Documents:
  • 1758_lentiBB_EGFP-P2A-HAUS6_IRES_Blast.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry