pGEX-2T-TRR-C421-G2304D
(Plasmid #182845)

• Purpose: mutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sites
• Depositing Lab: Peter Harte
• Publication: Tie et al Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392.

Backbone

• Vector backbone: pGEX-2T
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 6163
• Modifications to backbone: add NdeI and NsiI sites between BamHI and EcoRI sites
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRR 2011-2431
• Alt name: trithorax-related
• Species: D. melanogaster (fly)
• Insert Size (bp): 1263
• Mutation: mutation G2304D (GGC/GAC)
• Entrez Gene: trr (a.k.a. Dmel_CG3848, CG3848, Dmel\CG3848, EG:63B12.3, TRR, Trr, anon-2Bb, dmll3/4)
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: atgggtgcaggagcaggcgccac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA clones of TRR (SD13650) was obtained from the Drosophila Genomics Resource Center (DGRC).

Additional mutation was found at Q2050L. This is outside of the TRR SET domain (2293-2431 aa) and has no effect on its enzyme activity.