pGEX-2T-TRX-C751-E3616S
(Plasmid #182844)

• Purpose: mutation E3616S (GAA/TCA), PCR product coding C-terminal residues 2976-3726 of TRX was inserted into modified pGEX-2T by Nde I-Nsi I sites. Expression in E. coli. by IPTG induction
• Depositing Lab: Peter Harte
• Publication: Tie et al Development. 2014 Mar;141(5):1129-39. doi: 10.1242/dev.102392.

Backbone

• Vector backbone: pGEX-2T
• Backbone size w/o insert (bp): 4900
• Total vector size (bp): 7153
• Modifications to backbone: add NdeI and NsiI between BamHI and EcoRI sites
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRX
• Alt name: trithorax
• Species: D. melanogaster (fly)
• Insert Size (bp): 2253
• Entrez Gene: w (a.k.a. Dmel_CG2759, BACN33B1.1, CG2759, DMWHITE, DmWhite, Dmel\CG2759, EG:BACN33B1.1, W, White, c23, e(g), m(g), mini-white, mw, w(AT)[[13]])
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: NsiI (not destroyed)
• 5′ sequencing primer: CAT ATGATCCATATTCCCCAGCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA clone of TRX (LD39445) was obtained from the Drosophila Genomics Resource Center (DGRC).