pAct-GST-H3(K27Q)
(Plasmid
#182843)
-
Purposea K27Q point mutation (AAG/CAG) of Drosophila histone H3 was generated from pAct-GST-H3. Expression in S2 cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAct5C
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 5600
-
Modifications to backboneinserted by Sac I and Sal I sites. (sequences between Sac I and Sal I sites are removed)
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGST-histone H3 fusion
-
Alt nameGST-H3
-
SpeciesD. melanogaster (fly)
- Promoter Actin5C
-
Tag
/ Fusion Protein
- GST
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac I and Sal I (not destroyed)
- 3′ cloning site Sal I (not destroyed)
- 5′ sequencing primer GAGCTCATGTCCCCTATACTAGGTTAT
- 3′ sequencing primer TTAGGCCCGCTCGCCACGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAct-GST-H3(K27Q) was a gift from Peter Harte (Addgene plasmid # 182843 ; http://n2t.net/addgene:182843 ; RRID:Addgene_182843) -
For your References section:
CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Tie F, Banerjee R, Stratton CA, Prasad-Sinha J, Stepanik V, Zlobin A, Diaz MO, Scacheri PC, Harte PJ. Development. 2009 Sep;136(18):3131-41. doi: 10.1242/dev.037127. 10.1242/dev.037127 PubMed 19700617