Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAct-GST-H3(K27Q)
(Plasmid #182843)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182843 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAct5C
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 5600
  • Modifications to backbone
    inserted by Sac I and Sal I sites. (sequences between Sac I and Sal I sites are removed)
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GST-histone H3 fusion
  • Alt name
    GST-H3
  • Species
    D. melanogaster (fly)
  • Promoter Actin5C
  • Tag / Fusion Protein
    • GST

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sac I and Sal I (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer GAGCTCATGTCCCCTATACTAGGTTAT
  • 3′ sequencing primer TTAGGCCCGCTCGCCACGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAct-GST-H3(K27Q) was a gift from Peter Harte (Addgene plasmid # 182843 ; http://n2t.net/addgene:182843 ; RRID:Addgene_182843)
  • For your References section:

    CBP-mediated acetylation of histone H3 lysine 27 antagonizes Drosophila Polycomb silencing. Tie F, Banerjee R, Stratton CA, Prasad-Sinha J, Stepanik V, Zlobin A, Diaz MO, Scacheri PC, Harte PJ. Development. 2009 Sep;136(18):3131-41. doi: 10.1242/dev.037127. 10.1242/dev.037127 PubMed 19700617