pPBO.ACT001
(Plasmid #182711)

• Purpose: aTc inducible dCasRx
• Depositing Lab: Joseph Schoeniger
• Publication: Otoupal et al Nucleic Acids Res. 2022 Aug 11. pii: 6660959. doi: 10.1093/nar/gkac680.

Backbone

• Vector backbone: p15a ORI
• Backbone size w/o insert (bp): 2761
• Total vector size (bp): 5716
• Modifications to backbone: N/A
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dCasRx
• Alt name: dRfxCas13d
• Alt name: dCas13
• Species: Ruminococcus flavefaciens XPD3002
• Insert Size (bp): 2955
• Mutation: Catalytically deactivated R295A, H300A, R849A, H854A
• GenBank ID: 891778
• Promoter: pTet
• Tag / Fusion Protein:
  • 2x-FLAG (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: taagcagctctaatgcgc
• 3′ sequencing primer: gatttcgtgatgcttgtcaggg

Resource Information

• Supplemental Documents:
  • pPBOACT.001_dCasRX.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid pPBO.ACT001 was built using a dCasRx construct obtained from Emeric Charles at the University of California at Berkeley's labs of David Savage and Jennifer Doudna. Please cite the associated publication in any use of this plasmid: https://doi.org/10.1101/2021.05.26.445687. dCasRx was originally identified and created by Silvana Konnerman et al in the following publication. A variant of dCasRx can be obtained from Addgene deposit #109050. Please also cite the associated publication in any use of this plasmid: DOI: 10.1016/j.cell.2018.02.033

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This material is based upon work supported by the U. S. Department of Energy, Office of Science, through the Genomic Science Program, Office of Biological and Environmental Research, under the Secure Biosystems Design Initiative. Sandia National Laboratories is managed by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy under contract no. DE-NA-0003525.