Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pORANGE_NFL linker-3xFLAG KI
(Plasmid #182679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182679 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pORANGE
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nefl-targeting gRNA and linker-3xFLAG donor sequence
  • Alt name
    Nefl
  • gRNA/shRNA sequence
    GAGTGCTGGAGAGGAGCAGG
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Entrez Gene
    Nefl (a.k.a. CMT2E, NF-L, NF68, Nfl)
  • Promoter U6 and chicken beta-actin promoter

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Following pORANGE cloning template vector (https://www.addgene.org/131471/) was used as a vector backbone.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pORANGE_NFL linker-3xFLAG KI was a gift from Ivana Nikić-Spiegel (Addgene plasmid # 182679 ; http://n2t.net/addgene:182679 ; RRID:Addgene_182679)
  • For your References section:

    Minimal genetically encoded tags for fluorescent protein labeling in living neurons. Arsic A, Hagemann C, Stajkovic N, Schubert T, Nikic-Spiegel I. Nat Commun. 2022 Jan 14;13(1):314. doi: 10.1038/s41467-022-27956-y. 10.1038/s41467-022-27956-y PubMed 35031604