Skip to main content
Addgene

scAAV-Mlc2v-MPRA
(Plasmid #182649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV
  • Total vector size (bp) 4470
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Promoter rat Mlc2v

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer cttcggtccgctttttggtac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    scAAV-Mlc2v-MPRA was a gift from William Pu (Addgene plasmid # 182649 ; http://n2t.net/addgene:182649 ; RRID:Addgene_182649)
  • For your References section:

    A reference map of murine cardiac transcription factor chromatin occupancy identifies dynamic and conserved enhancers. Akerberg BN, Gu F, VanDusen NJ, Zhang X, Dong R, Li K, Zhang B, Zhou B, Sethi I, Ma Q, Wasson L, Wen T, Liu J, Dong K, Conlon FL, Zhou J, Yuan GC, Zhou P, Pu WT. Nat Commun. 2019 Oct 28;10(1):4907. doi: 10.1038/s41467-019-12812-3. 10.1038/s41467-019-12812-3 PubMed 31659164