Skip to main content
Addgene

pWZL hygro-hTCAB1
(Plasmid #182593)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182593 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pWZL
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7257
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hTCAB1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1641
  • Entrez Gene
    WRAP53 (a.k.a. DKCB3, TCAB1, WDR79)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site popOMI (unknown if destroyed)
  • 5′ sequencing primer GTGTGGTGGTACGTAGG
  • 3′ sequencing primer ATCAGCTCACCCACACCTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWZL hygro-hTCAB1 was a gift from Agnel Sfeir (Addgene plasmid # 182593 ; http://n2t.net/addgene:182593 ; RRID:Addgene_182593)
  • For your References section:

    Single-Molecule Imaging of Telomerase RNA Reveals a Recruitment-Retention Model for Telomere Elongation. Laprade H, Querido E, Smith MJ, Guerit D, Crimmins H, Conomos D, Pourret E, Chartrand P, Sfeir A. Mol Cell. 2020 Jul 2;79(1):115-126.e6. doi: 10.1016/j.molcel.2020.05.005. Epub 2020 Jun 3. 10.1016/j.molcel.2020.05.005 PubMed 32497497