MCS-3_Endofin_LgBiT
(Plasmid #182574)

• Purpose: This plasmid can be used to monitor receptor internalization in real time living cells using bioluminescence as a readout.
• Depositing Lab: Bradley McConnell
• Publication: Reyes-Alcaraz et al Commun Biol. 2022 Mar 8;5(1):212. doi: 10.1038/s42003-022-03163-9.

Backbone

• Vector backbone: pBiT1.1-C [TK/LgBiT]
• Backbone manufacturer: Promega Corporation
• Total vector size (bp): 4056
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: zinc finger FYVE-type
• Alt name: FYVE domain
• Species: H. sapiens (human)
• Insert Size (bp): 207
• Mutation: FYVE domain Q739-K806
• Entrez Gene: ZFYVE16 (a.k.a. PPP1R69)
• Promoter: Herpes simplex virus (HSV)
• Tag / Fusion Protein:
  • LgBiT (Large BiT) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BgIII (unknown if destroyed)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: caccgagcgaccctgcagcga
• 3′ sequencing primer: attgatgagtttggacaaacc

Resource Information

• Supplemental Documents:
  • Endofin_LgBiT.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry