PX552-rScn2a-3xV5-Syn-miRFP670
(Plasmid
#182566)
-
PurposeFor rat Nav1.2 knockin with 3xV5 at the extracellular loop
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX552
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namerat Scn2a gRNA and 3xV5 donor DNA
-
SpeciesR. norvegicus (rat)
-
GenBank IDNM_012647.2
- Promoter U6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TTCTTGGGTAGTTTGCAGTTTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemiRFP670
-
Insert Size (bp)948
- Promoter Syn
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGCGGAGGAGTCGTGTCGT
- 3′ sequencing primer CCGCAGGCCCTACAGGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX552-rScn2a-3xV5-Syn-miRFP670 was a gift from James Zhe Liu (Addgene plasmid # 182566 ; http://n2t.net/addgene:182566 ; RRID:Addgene_182566) -
For your References section:
Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149