piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry
(Plasmid
#182560)
-
PurposeExpresses Nav1.6 ICL1 tagged with sfGFP-P2A-mCherry
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePiggybac
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemouse Scn8a ICL1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1029
-
GenBank IDNM_001077499.2
- Promoter Syn
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGCGGAGGAGTCGTGTCGT
- 3′ sequencing primer AAGACGGCAATATGGTGGAAAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesfGFP-P2A-mCherry
-
Insert Size (bp)1485
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry was a gift from James Zhe Liu (Addgene plasmid # 182560 ; http://n2t.net/addgene:182560 ; RRID:Addgene_182560) -
For your References section:
Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149