Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

piggybac-Syn-mScn8a-3xHA
(Plasmid #182555)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182555 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Piggybac
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Scn8a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    6060
  • GenBank ID
    NM_001077499.2
  • Entrez Gene
    Scn8a (a.k.a. C630029C19Rik, NaCh6, Nav1.6, dmu, med, mnd-2, mnd2, nmf2, nmf335, nmf58, nur14, seal)
  • Promoter Syn
  • Tag / Fusion Protein
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAGCGGAGGAGTCGTGTCGT
  • 3′ sequencing primer AAGACGGCAATATGGTGGAAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piggybac-Syn-mScn8a-3xHA was a gift from James Zhe Liu (Addgene plasmid # 182555 ; http://n2t.net/addgene:182555 ; RRID:Addgene_182555)
  • For your References section:

    Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149