Addgene: pSpCas9-Puro HLAG-2B-sgRNA Skip to main content
Addgene

pSpCas9-Puro HLAG-2B-sgRNA
(Plasmid #182552)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182552 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX459
  • Backbone manufacturer
    Dr. Feng Zhang's Lab
  • Total vector size (bp) 9176
  • Modifications to backbone
    2B-sgRNA targeting exon 2 HLA-G gene
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSpCas9-2A-Puro-HLAG-2B-sgRNA
  • gRNA/shRNA sequence
    GGACTTTAGAACCAGGACCG
  • Species
    Synthetic
  • Promoter Cbh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer hU6-F primer (5'-GAGGGCCTATTTCCCATGATT-3')
  • 3′ sequencing primer 2B-sgRNA Rv (5'-CGGTCCTGGTTCTAAAGTCC-3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is a version of Addgene Plasmid #62988 where the guide sequence HLAG/2B-sgRNA was cloned into this plasmid using BbsI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9-Puro HLAG-2B-sgRNA was a gift from Santiago Miriuka (Addgene plasmid # 182552 ; http://n2t.net/addgene:182552 ; RRID:Addgene_182552)
  • For your References section:

    HLA-G gene editing in tumor cell lines as a novel alternative in cancer immunotherapy. Palma MB, Tronik-Le Roux D, Amin G, Castaneda S, Mobbs AM, Scarafia MA, La Greca A, Daouya M, Poras I, Inda AM, Moro LN, Carosella ED, Garcia MN, Miriuka SG. Sci Rep. 2021 Nov 12;11(1):22158. doi: 10.1038/s41598-021-01572-0. 10.1038/s41598-021-01572-0 PubMed 34773056