-
PurposeExpress Fluorescent RADARS in bicistronic vector with mCherry as control gene
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182540 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNEB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemNeon
-
GenBank IDLC279210.1
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cacaacgaggactacaccatcgtg
- 3′ sequencing primer gtcttcttcgcctttgctgaccat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.01.26.477951 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDY1243-Fluorescent RADARS was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 182540 ; http://n2t.net/addgene:182540 ; RRID:Addgene_182540) -
For your References section:
Programmable eukaryotic protein synthesis with RNA sensors by harnessing ADAR. Jiang K, Koob J, Chen XD, Krajeski RN, Zhang Y, Volf V, Zhou W, Sgrizzi SR, Villiger L, Gootenberg JS, Chen F, Abudayyeh OO. Nat Biotechnol. 2022 Oct 27. pii: 10.1038/s41587-022-01534-5. doi: 10.1038/s41587-022-01534-5. 10.1038/s41587-022-01534-5 PubMed 36302988