Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDY1243-Fluorescent RADARS
(Plasmid #182540)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182540 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR322
  • Backbone manufacturer
    NEB
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mNeon
  • GenBank ID
    LC279210.1
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cacaacgaggactacaccatcgtg
  • 3′ sequencing primer gtcttcttcgcctttgctgaccat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.01.26.477951 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDY1243-Fluorescent RADARS was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 182540 ; http://n2t.net/addgene:182540 ; RRID:Addgene_182540)
  • For your References section:

    Programmable eukaryotic protein synthesis with RNA sensors by harnessing ADAR. Jiang K, Koob J, Chen XD, Krajeski RN, Zhang Y, Volf V, Zhou W, Sgrizzi SR, Villiger L, Gootenberg JS, Chen F, Abudayyeh OO. Nat Biotechnol. 2022 Oct 27. pii: 10.1038/s41587-022-01534-5. doi: 10.1038/s41587-022-01534-5. 10.1038/s41587-022-01534-5 PubMed 36302988