T7-Phi6-P2
(Plasmid
#182535)
-
PurposeTemplate for production of Phi6 P2 RNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneT7-CMVtrans-FFLuc-polyA
- Backbone size w/o insert (bp) 3703
- Total vector size (bp) 5177
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameP2 pol
-
SpeciesPseudomonas virus phi6
-
Insert Size (bp)1474
-
GenBank IDNC_003715.1
- Promoter T7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GGTAGGGCGACCAAGAACTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
T7-Phi6-P2 was a gift from Peter Sarin (Addgene plasmid # 182535 ; http://n2t.net/addgene:182535 ; RRID:Addgene_182535) -
For your References section:
An improved RT-qPCR method for direct quantification of enveloped RNA viruses. Gregorova P, Heinonen MK, Sarin LP. MethodsX. 2022 May 23;9:101737. doi: 10.1016/j.mex.2022.101737. eCollection 2022. 10.1016/j.mex.2022.101737 PubMed 35669085