Skip to main content
Addgene

pC23-LIC-STREP
(Plasmid #182507)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182507 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET23
  • Backbone manufacturer
    Novagen
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tag / Fusion Protein
    • TEV-STREP (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 Forward
  • 3′ sequencing primer T7 Terminator
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5’ end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3’ end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC23-LIC-STREP was a gift from Renato Bruni (Addgene plasmid # 182507 ; http://n2t.net/addgene:182507 ; RRID:Addgene_182507)