pC23-LIC-STREP
(Plasmid
#182507)
-
Purpose(Empty Backbone) pET based vector for protein expression in E.coli for targets fused with C-terminal STREP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182507 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepET23
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
- Promoter T7
-
Tag
/ Fusion Protein
- TEV-STREP (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer T7 Forward
- 3′ sequencing primer T7 Terminator (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Primers for LIC cloning: Upstream: add TTAAGAAGGAGATATACT to the 5’ end of gene of interest. Downstream: add TGAAAATAGAGGTTTTCGGC to the 3’ end of GOI. Detailed cloning method available in the paper Bruni R, Kloss B. High-throughput cloning and expression of integral membrane proteins in Escherichia coli. Curr Protoc Protein Sci. 2013 Nov 5;74:29.6.1-29.6.34.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pC23-LIC-STREP was a gift from Renato Bruni (Addgene plasmid # 182507 ; http://n2t.net/addgene:182507 ; RRID:Addgene_182507)
Map uploaded by the depositor.
