Skip to main content
Addgene

pAAV-flex-GFP-shRNA-scramble
(Plasmid #182503)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182503 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 3000
  • Total vector size (bp) 6076
  • Vector type
    Mammalian Expression, AAV, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pan neuronal promoter driving flexed GFP-shRNA scramble from mir 30 cassette
  • Species
    Synthetic
  • Insert Size (bp)
    3319
  • Promoter hSyn promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Apa1 (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer aaactccccttcccggcc
  • 3′ sequencing primer GAAGTTCACCTTGATGCCGTTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note Addgene NGS identified a IS4 transposase element in this plasmid. Depositor confirms this does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-flex-GFP-shRNA-scramble was a gift from William Wisden (Addgene plasmid # 182503 ; http://n2t.net/addgene:182503 ; RRID:Addgene_182503)

  • For your References section:

    NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726
Related items:
Commonly requested with: