pTET GFP10-FRB/FKBP-GFP11
(Plasmid #182497)

• Purpose: Tripartite split-GFP. E. coli vector. Inducible coexpression of GFP10-FRB and FKBP-GFP11 coiled coils
• Depositing Lab: Stéphanie Cabantous
• Publication: Pedelacq et al Methods Mol Biol. 2019;2025:423-437. doi: 10.1007/978-1-4939-9624-7_20.

Backbone

• Vector backbone: pTET (PROTET)
• Total vector size (bp): 3987
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: FRB
• Alt name: FRB domain of mTOR
• Species: H. sapiens (human), Synthetic
• Promoter: TET
• Tag / Fusion Protein:
  • split GFP10 tripartite (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: TCGAGTCCCTATCAGTGATAGAG
• 3′ sequencing primer: CGGATTTGTCCTACTCAGGAGAG

Gene/Insert 2

• Gene/Insert name: FKBP
• Alt name: FK506 binding protein 1A
• Species: M. musculus (mouse), Synthetic
• Entrez Gene: Fkbp1a (a.k.a. FKBP12, Fkbp, Fkbp1)
• Promoter: TET
• Tag / Fusion Protein:
  • split GFP11 tripartite (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TCGAGTCCCTATCAGTGATAGAG
• 3′ sequencing primer: CGGATTTGTCCTACTCAGGAGAG

Resource Information

• Supplemental Documents:
  • pTet GFP10-FRB-IRBS-FKBPGFP11 short linkers.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry