pTET GFP10-FRB/FKBP-GFP11
(Plasmid
#182497)
-
PurposeTripartite split-GFP. E. coli vector. Inducible coexpression of GFP10-FRB and FKBP-GFP11 coiled coils
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182497 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTET (PROTET)
- Total vector size (bp) 3987
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameFRB
-
Alt nameFRB domain of mTOR
-
SpeciesH. sapiens (human), Synthetic
- Promoter TET
-
Tag
/ Fusion Protein
- split GFP10 tripartite (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer TCGAGTCCCTATCAGTGATAGAG
- 3′ sequencing primer CGGATTTGTCCTACTCAGGAGAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFKBP
-
Alt nameFK506 binding protein 1A
-
SpeciesM. musculus (mouse), Synthetic
- Promoter TET
-
Tag
/ Fusion Protein
- split GFP11 tripartite (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCGAGTCCCTATCAGTGATAGAG
- 3′ sequencing primer CGGATTTGTCCTACTCAGGAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTET GFP10-FRB/FKBP-GFP11 was a gift from Stéphanie Cabantous (Addgene plasmid # 182497 ; http://n2t.net/addgene:182497 ; RRID:Addgene_182497) -
For your References section:
High-Throughput Protein-Protein Interaction Assays Using Tripartite Split-GFP Complementation. Pedelacq JD, Waldo GS, Cabantous S. Methods Mol Biol. 2019;2025:423-437. doi: 10.1007/978-1-4939-9624-7_20. 10.1007/978-1-4939-9624-7_20 PubMed 31267465