Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SPRR2A-pFastBac I
(Plasmid #182460)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182460 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBac1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4688
  • Total vector size (bp) 4925
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    small proline rich protein 2A
  • Alt name
    SPRR2A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    237
  • GenBank ID
    NM_005988 NM_005988
  • Entrez Gene
    SPRR2A
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SPRR2A-pFastBac I was a gift from Lora Hooper (Addgene plasmid # 182460 ; http://n2t.net/addgene:182460 ; RRID:Addgene_182460)
  • For your References section:

    Small proline-rich protein 2A is a gut bactericidal protein deployed during helminth infection. Hu Z, Zhang C, Sifuentes-Dominguez L, Zarek CM, Propheter DC, Kuang Z, Wang Y, Pendse M, Ruhn KA, Hassell B, Behrendt CL, Zhang B, Raj P, Harris-Tryon TA, Reese TA, Hooper LV. Science. 2021 Nov 5;374(6568):eabe6723. doi: 10.1126/science.abe6723. Epub 2021 Nov 5. 10.1126/science.abe6723 PubMed 34735226