SPRR2A-pFastBac I
(Plasmid
#182460)
-
PurposeExpression His-tagged SPRR2A in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4688
- Total vector size (bp) 4925
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesmall proline rich protein 2A
-
Alt nameSPRR2A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)237
-
GenBank IDNM_005988 NM_005988
-
Entrez GeneSPRR2A
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SPRR2A-pFastBac I was a gift from Lora Hooper (Addgene plasmid # 182460 ; http://n2t.net/addgene:182460 ; RRID:Addgene_182460) -
For your References section:
Small proline-rich protein 2A is a gut bactericidal protein deployed during helminth infection. Hu Z, Zhang C, Sifuentes-Dominguez L, Zarek CM, Propheter DC, Kuang Z, Wang Y, Pendse M, Ruhn KA, Hassell B, Behrendt CL, Zhang B, Raj P, Harris-Tryon TA, Reese TA, Hooper LV. Science. 2021 Nov 5;374(6568):eabe6723. doi: 10.1126/science.abe6723. Epub 2021 Nov 5. 10.1126/science.abe6723 PubMed 34735226