Linked Free NES (M)
(Plasmid
#182436)
-
PurposeYeast integrative plasmid for expressing fusion protein ERG20(F96W-N127W)-AcNES1 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepILGFPB5A
-
Vector typeYeast Expression, Synthetic Biology ; Metabolic engineering
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFPPS(M)-NES
-
Alt nameERG20(F96W-N127W)-AcNES1, nerolidol/linalool synthase
-
SpeciesS. cerevisiae (budding yeast), Synthetic; Actinidia chinensis
-
Insert Size (bp)2817
- Promoter GAL10
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGTAATGCCATGTAATATGATTATTAAAC
- 3′ sequencing primer GCATTGGCACGGTGCAACAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.11.24.517869v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Linked Free NES (M) was a gift from Claudia Vickers (Addgene plasmid # 182436 ; http://n2t.net/addgene:182436 ; RRID:Addgene_182436) -
For your References section:
Synthetic in vivo compartmentalisation improves metabolic flux and modulates the product profile of promiscuous enzymes. Li Chen Cheah , Lian Liu , Manuel R. Plan, Bingyin Peng , Zeyu Lu , Gerhard Schenk , Claudia E. Vickers , Frank Sainsbury. BioRxiv, 2022 10.1101/2022.11.24.517869