psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1
(Plasmid
#182380)
-
PurposeDual expression construct encoding shRNA-resistant mtIF3 and mito-mTFP1 from separate promoters
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepsiCheck2
- Backbone size w/o insert (bp) 3386
- Total vector size (bp) 5201
-
Modifications to backboneChanged HSV TK promoter to CMV promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namemtIF3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)903
-
MutationChanged CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant)
-
GenBank IDNM_001256101.1
-
Entrez GeneMtif3 (a.k.a. 2810012L14Rik, AI414549)
- Promoter SV40 promoter
-
Tag
/ Fusion Protein
- 3xFlag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AATACGACTCACTATAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemito-mTFP1
-
SpeciesSynthetic
-
Insert Size (bp)912
- Promoter CMV promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTGTGTTGGTTTTTTGTGTG
- 3′ sequencing primer AAATAAAGCAATAGCATCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCheck2-SV40p-mtIF3(SR)-3xFLAG-CMVp-mito-mTFP1 was a gift from Chunghun Lim (Addgene plasmid # 182380 ; http://n2t.net/addgene:182380 ; RRID:Addgene_182380) -
For your References section:
mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455