Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry
(Plasmid #182379)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182379 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    psiCheck2
  • Backbone size w/o insert (bp) 3679
  • Total vector size (bp) 9563
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mtIF3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    5173
  • Mutation
    Changed CDS sequence from 'ccacgttcaagtcacgataaa' to 'tcatgtacaggtgaccattaa' (shRNA-resistant)
  • GenBank ID
    NM_001256101.1
  • Entrez Gene
    Mtif3 (a.k.a. 2810012L14Rik, AI414549)
  • Promoter SV40 promoter
  • Tag / Fusion Protein
    • 3xFlag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer AATACGACTCACTATAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    711
  • Promoter HSV TK promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site XbaI (destroyed during cloning)
  • 5′ sequencing primer AAGCTTGGCATTCCGGTACT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck2-SV40p-5'UTR-mtIF3(SR)-3xFLAG-3'UTR-HSVTKp-mCherry was a gift from Chunghun Lim (Addgene plasmid # 182379 ; http://n2t.net/addgene:182379 ; RRID:Addgene_182379)
  • For your References section:

    mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455