psiCheck2-SV40p-3xFLAG-HSVTKp-mCherry
(Plasmid #182377)

• Purpose: Dual expression construct encoding 3xFLAG and mCherry from separate promoters
• Depositing Lab: Chunghun Lim
• Publication: Lee et al BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w.

Backbone

• Vector backbone: psiCheck2
• Backbone size w/o insert (bp): 3639
• Total vector size (bp): 4422
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: 3xFlag
• Species: Synthetic
• Insert Size (bp): 72
• Promoter: SV40 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: AATACGACTCACTATAG

Gene/Insert 2

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: HSV TK promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: ApaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: AAGCTTGGCATTCCGGTACT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry