pcDNA6-MRPL50-VC155
(Plasmid
#182373)
-
PurposemVenus-based mito-riboBiFC vector (Negative control)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182373 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 5060
- Total vector size (bp) 5819
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMrpl50
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)759
-
GenBank IDNM_178603.4
-
Entrez GeneMrpl50 (a.k.a. AA408971, AI317351, D4Wsu125e)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- VC155 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA6-MRPL50-VC155 was a gift from Chunghun Lim (Addgene plasmid # 182373 ; http://n2t.net/addgene:182373 ; RRID:Addgene_182373) -
For your References section:
mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455
Map uploaded by the depositor.
