Skip to main content
Addgene

pAAV2-mtIF3 shRNA_TagRFP657
(Plasmid #182367)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182367 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 5813
  • Total vector size (bp) 5869
  • Modifications to backbone
    TagRFP657 expression from separated promoter
  • Vector type
    Mammalian Expression, AAV, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mtIF3
  • gRNA/shRNA sequence
    CCACGTTCAAGTCACGATAAAGA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001256101.1
  • Entrez Gene
    Mtif3 (a.k.a. 2810012L14Rik, AI414549)
  • Promoter U6 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XbaI (destroyed during cloning)
  • 5′ sequencing primer GGG CAG GAA GAG GGC CTA T
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV2-mtIF3 shRNA_TagRFP657 was a gift from Chunghun Lim (Addgene plasmid # 182367 ; http://n2t.net/addgene:182367 ; RRID:Addgene_182367)

  • For your References section:

    mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455
Related items:
Commonly requested with: