-
PurposeExpresses Neq2X7 DNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7999
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNeq2X7 DNA polymerase
-
SpeciesNanoarchaeum equitans
-
Insert Size (bp)2640
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgattttagatgtggattacataactgaagaaggaaaac
- 3′ sequencing primer ctgcagatgctggagaagcagaaaaagtag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484273v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Neq2X7 was a gift from Morten Norholm (Addgene plasmid # 182366 ; http://n2t.net/addgene:182366 ; RRID:Addgene_182366) -
For your References section:
Neq2X7: a multi-purpose and open-source fusion DNA polymerase for advanced DNA engineering and diagnostics PCR. Hernandez-Rollan C, Ehrmann AK, Vlassis A, Kandasamy V, Norholm MHH. BMC Biotechnol. 2024 Apr 2;24(1):17. doi: 10.1186/s12896-024-00844-7. 10.1186/s12896-024-00844-7 PubMed 38566117