Skip to main content
Addgene

pET-Neq2X7
(Plasmid #182366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182366 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7999
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Neq2X7 DNA polymerase
  • Species
    Nanoarchaeum equitans
  • Insert Size (bp)
    2640
  • Promoter T7
  • Tag / Fusion Protein
    • His-tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atgattttagatgtggattacataactgaagaaggaaaac
  • 3′ sequencing primer ctgcagatgctggagaagcagaaaaagtag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-Neq2X7 was a gift from Morten Norholm (Addgene plasmid # 182366 ; http://n2t.net/addgene:182366 ; RRID:Addgene_182366)
  • For your References section:

    Neq2X7: a multi-purpose and open-source fusion DNA polymerase for advanced DNA engineering and diagnostics PCR. Hernandez-Rollan C, Ehrmann AK, Vlassis A, Kandasamy V, Norholm MHH. BMC Biotechnol. 2024 Apr 2;24(1):17. doi: 10.1186/s12896-024-00844-7. 10.1186/s12896-024-00844-7 PubMed 38566117