pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus
(Plasmid
#182344)
-
PurposesgRNA4 for insertion of extrachromosomal arrays into the ce-unc-119 genomic locus. Use with pSEM371 fragment included in Ex array.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTwist-Amp-high-copy
-
Backbone manufacturerTwist Biosciences
- Total vector size (bp) 5028
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpacer 4
-
gRNA/shRNA sequenceGTTTGGGAACCAGGTGTTGG
-
SpeciesC. elegans (nematode)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
www.wormbuilder.org
MOdular Safe harbor Transgene Insertion (mosTI).
sgRNA4 for insertion of arrays into the ce-unc-119 genomic locus. Use with pSEM371 fragment included in Ex array injected into, for example, unc-119(ed3).
Please visit https://www.biorxiv.org/content/10.1101/2022.04.19.488726v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSEM376 - sgRNA - spc4 - array - insertion - unc-119 - locus was a gift from Christian Froekjaer-Jensen (Addgene plasmid # 182344 ; http://n2t.net/addgene:182344 ; RRID:Addgene_182344) -
For your References section:
Modular safe-harbor transgene insertion (MosTI) for targeted single-copy and extrachromosomal array integration in C. elegans. El Mouridi S, Alkhaldi F, Frokjaer-Jensen C. G3 (Bethesda). 2022 Jul 28. pii: 6651068. doi: 10.1093/g3journal/jkac184. 10.1093/g3journal/jkac184 PubMed 35900171