pGW-Dronpa-Cav1.2
(Plasmid
#182333)
-
PurposeL-type voltage-gated calcium channel α1C subunit tagged with Dronpa. Fluctuating green-fluorescent label for live-cell super-resolution imaging.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGW1
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 12000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCav1.2-Dronpa
-
Alt nameCACNA1C
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7194
-
MutationT1066Y, Q1070M
-
Entrez GeneCACNA1C (a.k.a. CACB, CaV1.2)
- Promoter CMV
-
Tag
/ Fusion Protein
- Full-length rabbit Cav1.2. (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCGCACAAGGCCGTGGCGGTAGGG
- 3′ sequencing primer SV40pA reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGW-Dronpa-Cav1.2 was a gift from Jin Zhang (Addgene plasmid # 182333 ; http://n2t.net/addgene:182333 ; RRID:Addgene_182333) -
For your References section:
DrFLINC Contextualizes Super-resolution Activity Imaging. Lin W, Mo GCH, Mehta S, Zhang J. J Am Chem Soc. 2021 Sep 22;143(37):14951-14955. doi: 10.1021/jacs.1c05530. Epub 2021 Sep 13. 10.1021/jacs.1c05530 PubMed 34516108