Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-ArcLight-ST
(Plasmid #182318)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182318 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4831
  • Total vector size (bp) 6295
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ArcLight-ST
  • Species
    Synthetic
  • Insert Size (bp)
    1464
  • Mutation
    Mutation in an amino acid Q217E of ArcLight-MT
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGGTTATTGTGCTGTCTCAT
  • 3′ sequencing primer CAGCCACCACCTTCTGATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-ArcLight-ST was a gift from Rafael Yuste (Addgene plasmid # 182318 ; http://n2t.net/addgene:182318 ; RRID:Addgene_182318)
  • For your References section:

    Simultaneous two-photon imaging of action potentials and subthreshold inputs in vivo. Bando Y, Wenzel M, Yuste R. Nat Commun. 2021 Dec 10;12(1):7229. doi: 10.1038/s41467-021-27444-9. 10.1038/s41467-021-27444-9 PubMed 34893595