PB-TO-NGN2-EMX1 BSD-mApple
(Plasmid #182311)

• Purpose: Piggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 and EMX1 expression, bsd selection, mApple
• Depositing Labs: iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward
• Publication: Characterization of iPSC lines for the iPSC Neurodegenerative Disease Initiative (iNDI) (unpublished)

Backbone

• Vector backbone: pUCM
• Backbone size w/o insert (bp): 13078
• Total vector size (bp): 14788
• Modifications to backbone: CAG-rtTA3G-polyA
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hNGN2-P2A-EMX1
• Species: H. sapiens (human)
• Insert Size (bp): 1659
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Entrez Gene: EMX1
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: ccgtaccacttcctaccctc

Gene/Insert 2

• Gene/Insert name: bsd-T2A-mycNLS-mApple
• Insert Size (bp): 1326
• Promoter: EF1a
• Tag / Fusion Protein:
  • T2A-mycNLS-mApple

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SwaI (not destroyed)
• 3′ cloning site: N/A (unknown if destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Resource Information

• Supplemental Documents:
  • L63-PB-TO-NGN2-EMX1 BSD-mApple.gbk
• A portion of this plasmid was derived from a plasmid made by: Michael Ward lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry