pRSET-TorA-6xHis-M13-pHCountdown-Calmodulin
(Plasmid #182305)

• Purpose: E. coli plasmid encoding a fusion between pH-Countdown and the calcium-binding domains of GECO 1.2 with a hexahistidine tag, targeted to the periplasm via the TorA presequence.
• Depositing Lab: Andrew York
• Publication: Seidel et al (2021), doi: 10.5281/zenodo.5810930

Backbone

• Vector backbone: pRSETB
• Backbone size w/o insert (bp): 2760
• Total vector size (bp): 4236
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pH-Countdown insertion into GECO 1.2 calcium sensing domains
• Species: Echinophyllia sp. SC22
• Insert Size (bp): 1642
• Mutation: Spontaneous mutation of calmodulin's penultimate residue to a threonine, which does not seem to perturb calcium binding
• Promoter: t7
• Tags / Fusion Proteins:
  • A modified TorA periplasmic targeting sequence plus a histidine tag (N terminal on insert)
  • non-translated SSrA degradation signal (after the stop codon) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pRSET-TorA-6xHis-M13-pHCountdown-Calmodulin.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930