pUC57-Peft-pHCountdown-unc54
(Plasmid
#182304)
-
PurposeC. elegans plasmid encoding pH-Countdown with three introns
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC57
- Backbone size w/o insert (bp) 2626
- Total vector size (bp) 4843
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepH countdown with 3 introns, with a Peft3 promoter and unc54 terminator
-
SpeciesEchinophyllia sp. SC22
- Promoter Peft-3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site TspMI (not destroyed)
- 5′ sequencing primer attctctctaccgtccgc
- 3′ sequencing primer gttagaggtgacttaaaagaagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-Peft-pHCountdown-unc54 was a gift from Andrew York (Addgene plasmid # 182304 ; http://n2t.net/addgene:182304 ; RRID:Addgene_182304) -
For your References section:
Relaxation Sensors. Seidel ZP, Wang JCK, Riegler J, York AG, Ingaramo M. (2021), doi: 10.5281/zenodo.5810930 10.5281/zenodo.5810930