XRE-H2B-mScarlet-I
(Plasmid #182296)

• Purpose: Fluorescent reporter for AhR activity
• Depositing Labs: Severine Degrelle, Thierry Fournier
• Publication: Degrelle et al Environ Int. 2022 Sep 24;169:107545. doi: 10.1016/j.envint.2022.107545.

Backbone

• Vector backbone: XRE-H2B-eGFP
• Backbone manufacturer: Addgene #182294
• Backbone size w/o insert (bp): 5461
• Total vector size (bp): 6136
• Modifications to backbone: eGFP sequence was removed and replaced by mScarlet-I
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mScarlet-I
• Species: Synthetic
• Insert Size (bp): 696
• Tag / Fusion Protein:
  • m-Scarlet-I (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: MfeI (unknown if destroyed)
• 5′ sequencing primer: CACCATGCCAGAGCCAG
• 3′ sequencing primer: GGCTGATTATGATCTAGAGTCGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Gadella Lab (Addgene #85086).