pAW2-Smed-Slit-1
(Plasmid #182264)

• Purpose: dsRNA and riboprobe synthesis for Schmidtea mediterranea Slit-1
• Depositing Lab: Daniel Lobo
• Publication: Wolff et al STAR Protoc. 2022 Jun 14;3(3):101458. doi: 10.1016/j.xpro.2022.101458. eCollection 2022 Sep 16.

Backbone

• Vector backbone: pDL1
• Backbone manufacturer: Daniel Lobo
• Backbone size w/o insert (bp): 2319
• Total vector size (bp): 3053
• Vector type: Gibson cloning vector for synthesis of single and double stranded RNA

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Smed-Slit-1
• Alt name: dd_Smed_v6_12111_0_1
• Species: Schmidtea mediterranea
• Insert Size (bp): 860
• GenBank ID: DQ336176

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GACTTGCCAGTCACCAATCATA
• 3′ sequencing primer: TTTTCCCATGAAATGGATAAGG

Resource Information

• Supplemental Documents:
  • pAW2-Smed-Slit-1
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use the vector for in vitro synthesis of sense and antisense riboprobes with T3 and SP6, respectively, and dsRNA with T7.