pAAV-iCre-2A-cherry
(Plasmid #182246)

• Purpose: Expresses iCre linked to mCherry. The promoter is a fragment of the hdc gene promoter which drives pan neuronal expression.
• Depositing Lab: William Wisden
• Publication: Miracca et al J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022.

Backbone

• Vector backbone: pUC
• Backbone size w/o insert (bp): 3100
• Total vector size (bp): 7483
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pan neuronal gene promoter (hdc) fragment driving iCre recombinase and 2A linked to mCherry
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 4400
• GenBank ID: 15186
• Promoter: fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: CATCCACTAAAGGGACTTCCAG
• 3′ sequencing primer: CTGGAAGGGATCTTTGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry