pTRIP CMV VHHG4
(Plasmid
#182236)
-
PurposeExpresses GFP nanobody for stable expression in mammalian cells
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182236 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTRIP CMV
- Backbone size w/o insert (bp) 9844
- Total vector size (bp) 10186
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-GFP nanobody
-
Alt nameGFP-binding fragment of a single-chain camelid antibody
-
Insert Size (bp)342
- Promoter CMV
-
Tags
/ Fusion Proteins
- Myc (C terminal on insert)
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer gtggctaagatctacagctg (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIP CMV VHHG4 was a gift from Stéphanie Cabantous (Addgene plasmid # 182236 ; http://n2t.net/addgene:182236 ; RRID:Addgene_182236) -
For your References section:
High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation. Koraichi F, Gence R, Bouchenot C, Grosjean S, Lajoie-Mazenc I, Favre G, Cabantous S. J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419. 10.1242/jcs.210419 PubMed 29192060
Map uploaded by the depositor.
