Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRIP TRE-BI GFP10-RHOA/RBD-GFP11
(Plasmid #182232)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182232 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRIP TRE
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10798
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ras homolog family member A
  • Species
    H. sapiens (human)
  • GenBank ID
    NM 001313944
  • Entrez Gene
    RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
  • Promoter TRE bidirectional
  • Tag / Fusion Protein
    • GFP10 (split-GFP tripartite) (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (unknown if destroyed)
  • 3′ cloning site NheI (unknown if destroyed)
  • 5′ sequencing primer ATTTCGAGCTCGGTACCG
  • 3′ sequencing primer gtggctaagatctacagctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rhotekin RHO binding domain (RBD)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    252
  • GenBank ID
    NM_001136227.1
  • Promoter TRE bidirectional
  • Tag / Fusion Protein
    • GFP11 (M4) (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CTGGAGAATTCACCGGTCATATG
  • 3′ sequencing primer ggacagcagagatccactt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIP TRE-BI GFP10-RHOA/RBD-GFP11 was a gift from Stéphanie Cabantous (Addgene plasmid # 182232 ; http://n2t.net/addgene:182232 ; RRID:Addgene_182232)
  • For your References section:

    High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation. Koraichi F, Gence R, Bouchenot C, Grosjean S, Lajoie-Mazenc I, Favre G, Cabantous S. J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419. 10.1242/jcs.210419 PubMed 29192060