Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMD2-VSVGmut
(Plasmid #182229)

Ordering

This material is available to academics and nonprofits only. This item is currently unavailable outside the US without additional regulatory approval. A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Item Catalog # Description Quantity Price (USD)
Plasmid 182229 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMD2
  • Backbone size w/o insert (bp) 4284
  • Total vector size (bp) 5820
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    This plasmids may run as a dimer. Please test multiple colonies to select the monomeric form.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSVGmut
  • Alt name
    G glycoprotein
  • Species
    Vesicular Stomatitis Virus
  • Insert Size (bp)
    1536
  • Mutation
    K47Q, R354A
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtgtgctggcccatcactttggcaaagcacgtgagatct
  • 3′ sequencing primer cagccaccactttctgataggcagcctgcactggtggggt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutations originally described in Nikolic et al 2018: https://www.nature.com/articles/s41467-018-03432-4.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMD2-VSVGmut was a gift from Michael Birnbaum (Addgene plasmid # 182229 ; http://n2t.net/addgene:182229 ; RRID:Addgene_182229)
  • For your References section:

    Antigen identification and high-throughput interaction mapping by reprogramming viral entry. Dobson CS, Reich AN, Gaglione S, Smith BE, Kim EJ, Dong J, Ronsard L, Okonkwo V, Lingwood D, Dougan M, Dougan SK, Birnbaum ME. Nat Methods. 2022 Apr;19(4):449-460. doi: 10.1038/s41592-022-01436-z. Epub 2022 Apr 8. 10.1038/s41592-022-01436-z PubMed 35396484