Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KI-eab2-GG
(Plasmid #182158)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182158 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTol2-eab2-GG
  • Backbone size w/o insert (bp) 7326
  • Total vector size (bp) 7856
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homologous arm
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    530
  • Promoter eab2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCACACAGGTCAGAGGTTTGTCC
  • 3′ sequencing primer GCATTGGAAAGGGTCGCTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    KI-eab2-GG was a gift from Hui Zong (Addgene plasmid # 182158 ; http://n2t.net/addgene:182158 ; RRID:Addgene_182158)
  • For your References section:

    zMADM (zebrafish mosaic analysis with double markers) for single-cell gene knockout and dual-lineage tracing. Xu B, Kucenas S, Zong H. Proc Natl Acad Sci U S A. 2022 Mar 1;119(9). pii: 2122529119. doi: 10.1073/pnas.2122529119. 10.1073/pnas.2122529119 PubMed 35197298