KI-eab2-GG
(Plasmid
#182158)
-
PurposeKnockin plasmid with homologous arm for making zMADM-GG zebrafish line
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTol2-eab2-GG
- Backbone size w/o insert (bp) 7326
- Total vector size (bp) 7856
-
Vector typeZebrafish Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomologous arm
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)530
- Promoter eab2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCACACAGGTCAGAGGTTTGTCC
- 3′ sequencing primer GCATTGGAAAGGGTCGCTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KI-eab2-GG was a gift from Hui Zong (Addgene plasmid # 182158 ; http://n2t.net/addgene:182158 ; RRID:Addgene_182158) -
For your References section:
zMADM (zebrafish mosaic analysis with double markers) for single-cell gene knockout and dual-lineage tracing. Xu B, Kucenas S, Zong H. Proc Natl Acad Sci U S A. 2022 Mar 1;119(9). pii: 2122529119. doi: 10.1073/pnas.2122529119. 10.1073/pnas.2122529119 PubMed 35197298