PP023 - CAG::QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
(Plasmid
#182063)
-
PurposeCo-expression of Arch-based voltage indicator (QuasAr6a) and membrane-localized calcium reporter (jRGECO1a-CAAX)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti_CAG
- Backbone size w/o insert (bp) 9691
- Total vector size (bp) 12967
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameQuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
-
SpeciesSynthetic
-
Insert Size (bp)3276
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCGGGCCCGGGATCTCGAG
- 3′ sequencing primer gcgtatccacatagcgtaaaaggagcaac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PP023 - CAG::QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX was a gift from Adam Cohen (Addgene plasmid # 182063 ; http://n2t.net/addgene:182063 ; RRID:Addgene_182063) -
For your References section:
Dendritic branch structure compartmentalizes voltage-dependent calcium influx in cortical layer 2/3 pyramidal cells. Landau AT, Park P, Wong-Campos JD, Tian H, Cohen AE, Sabatini BL. Elife. 2022 Mar 23;11. pii: 76993. doi: 10.7554/eLife.76993. 10.7554/eLife.76993 PubMed 35319464