pCDH1-CMV-HT-LC3-SV40-Hygro
(Plasmid
#182045)
-
PurposeLentiviral expression vector encoding HaloTag-LC3 for monitoring autophagosome closure
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDH1-CMV-MCS-SV40-Hygro
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAP1LC3B
-
Alt nameLC3B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)378
-
GenBank IDNM_022818.5
-
Entrez GeneMAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
- Promoter CMV
-
Tag
/ Fusion Protein
- HaloTag-TEV (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GAAGATTCTAGAACCATGGCAGAAATCGG
- 3′ sequencing primer TATAGGATCCCTACACTGACAATTTCATCCCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH1-CMV-HT-LC3-SV40-Hygro was a gift from Hong-Gang Wang (Addgene plasmid # 182045 ; http://n2t.net/addgene:182045 ; RRID:Addgene_182045) -
For your References section:
VPS37A directs ESCRT recruitment for phagophore closure. Takahashi Y, Liang X, Hattori T, Tang Z, He H, Chen H, Liu X, Abraham T, Imamura-Kawasawa Y, Buchkovich NJ, Young MM, Wang HG. J Cell Biol. 2019 Oct 7;218(10):3336-3354. doi: 10.1083/jcb.201902170. Epub 2019 Sep 13. 10.1083/jcb.201902170 PubMed 31519728